Let's go creating THE CREATOR (2023)

The trailer reminds me of the sci-fi Korean film Space Sweepers on Netflix I watched one night. But I guess a little kid being some kind of saviour / change agent and a scramble for him isn’t super new, either.

The Creator is a visually stunning but emotionally hollow effort…

Noooooooo!

This did not work for me at all. In this subgenre of men bonding with girls in a dystopian future, it lands far behind Children of Men, Logan and Prospect and settles around Babylon A.D. Horrible song choices, the dumbest special forces in a long time, explosion sizes varying wildly with regards to what the plot needs and some really weird and ill-fitting attempts at humor in the second act. Very gamey aesthetics, also, but that may be a plus for some.

But I should add that I haven’t enjoyed a single movie Gareth Edwards made.

Well now we gotta see it, right @Telefrog?

edit: whoops, I see I’m 2 days late to this one

Hahahaha.

It’s fun to joke about the “visually stunning” cliche. But in this case it is actually a fair description, especially once you find out that the budget was only $80M.

On a cerebral level, when watching the movie I knew that basically every shot to be a special effect shot. But the only way I could know which parts were special effects was by what would be impossible to do in the real world, not because anything looked off in any way. The renders and composites were just flawless, it might be the most impressive CGI work I’ve ever seen in any movie.

My guess at the budget was $150M, because I thought that was the absolute maximum anyone would give Edwards, not because I thought this movie could be made with that budget. Finding out that the real budget was just half of that was genuinely shocking. I just don’t understand it. Either the special effects house has some magic new tech and we’re about to enter a new age of film making, or… I don’t actually know what the alternative is.

It’s a shame about the script though. It’s an absolute garbage fire. There’s some superficially decent world-building, but it falls apart the moment you concentrate. The plot, the characters, or the dialogue don’t work even superficially.

Would I recommend this? Even though this is likely to be in the bottom 1/3rd of my 2023 movie ranking, I might still conditionally recommend it. Not because it’s a good or even decent movie, but because the visuals really do deserve a big screen in the way few movies do. And the visuals and style are all the movie has going for it. It really won’t be the same watching it from an iPad.

This seems to be the most detailed description of the process.

Basically all shoots were done on location but without custom sets, no mocap, no green screens, a single consumer grade camera. Basically nothing done up front to make the VFX work easier. They didn’t even have concept art done up front, but kind of winged it.

Then ILM took that, did some undisclosed magic to get high quality tracking from just that raw footage, and after that it was just standard renders and compositing, except no need to build full virtual sets since there was no green screen.

This still doesn’t answer how the CGI looks so good though, just how they made it for so cheap.

Well, we know in at least one scene, they just took footage of the real-life Beirut explosion and just put CG elements over it.

Oof. I did not like this. I think it was very pretty garbage. Great visuals. Terrible script.

Watched the movie. Enjoyed the visuals. The script is bad and full of convenient events and tropes.

If just ask me, they dropped the ball, they could have made a memorable movie, and instead they deployed a bunch of cheap tricks and expensive CGI with good artists.

At least we go the dumbest space station ever, maybe people will remember that.


The cowards. They really should have called this one “Nirmata”, but they ended with a weaker version.

My problems with THE CREATOR:

  • Sorry, but how fly the nomad travel?, in some scenes it appears to be below the clouds. In other scenes appear to be a space station. I have not problem with a spacefortress that could do both, but nowhere we see it changing height like that.
  • If you create AGI and are this realistic. A large group of people will have not problem considering them people. Hell, on one scene one of the USA militars consider them a new kind of people. The movie presents this like a novel idea. We settled that already in 1550. Valladolid debate - Wikipedia
  • Space Vietnam. Its not very convincing this world where people have access to IA, but uses WWI warfare. Is this “New Asia” country a failed state? they don’t have a army? How can the USA army operate so openly?. I mean, maybe theres are good explanations for all this, with examples from the real world, but where are these?. In one scene it appears like “New Asia” is like a country beyond the steel curtain, but in other scene looks like a failed state under USA invasion. What it is?
  • This Cool Retro Futurism. Contributed to the whole immersion breaking aspect of it all. Like silly walking bombs that act somewhat like a cartoon comic, but I actually enjoyed it all.

Every time I see somebody on the screen say “They are not real, they are only code”. Sorry m****f*****, is not ctttcactcgcactgaagcttcgcacccgaagaatgacgtattggttaagcttctgcccg
ctgctacactggaggtcttaaaacaatccccattagcagaggatgacgggtcggggcgtt
tagaaaaacgtcctgatgcgtgttgccctagatgggcggatgtgcgccggtgttgagctt
ccgtgtgcacccatacgtctcccgaaaatgactgtttaatctacgtaacagaatgacgcg
aacctcgcgctaaaccgctttgacctaggtctactgcacggactgccaacaaaggcgaga
gcctgacgccacagacgacacggcttggccaatccgtaagcgtaaattagaagatcggca
atgagagcgaaggcggccactccagcagatccgttttccggcaagagagccccaaaccat
aatcataagatatatccctaccgtcccgtagactggcaatgtacttaacatgaatgccta
taattagcaccggataagttacaagtttcttaattcctccaactgggaaaattaacgtgg
agtaagaggctcgatctagaccctgtgataagagtatgccgttgcacttgtgaactttac
tgggcttgttgaaaaccggacacagcgcccataataatggactttcgtaattcgactgtg
ggcacaacttttacgctgccaagctgtgaaggcgctcggatgaagagcgcgtagcacggt
ggtcgaattctggtttagcactccatactgagatgagctgaattggcccttaaaacagac
aagacagctactcgaattattttggcacttaggccaacactacgatggcccaaaggacca
ttgctaaacgagcgcacatcacgcgcatgcccgttatatagtaatatgaaagtacggtag
tccacgtggactgtaattgaatgataacgcataagtaaaagtacactgtgagctcggcta
gctactcgattctcgacagtgtttcatcaagccgctaagt part of your DNA?, it looks like code to me. DNA is literally instructions to build a living organism. Search other argument than “they are made of CODE”.

Yeah, all SFX, no brain. Which could be fine if the action were tighter and the movie were more focused on the action instead of the redemptive themes or whatever but it tries to be a message movie too, I feel like, and has absolutely no subtlety or skill at being that.

Also the SF stuff is all purely window dressing. There’s no sign that they’ve thought at all about how any of the tech shown would impact anything, how robots might actually behave or in any way differ from humans, or really basically anything. There are no ideas here.

Only good part of this movie was the Everything In Its Right Place aerial assault. I’ve never heard that song on high quality Dolby Atmos theatre speakers before, in a proper surround mix. It blew me away. Everything after that was downhill. And it was pretty much one of the first scenes of the movie.

Well now you’ve got me curious if it’s better than the song’s usage in Vanilla Sky, which kind of blew my mind at the time.

I’d say it’s better. But I can barely remember the Vanilla Sky use. So that one wasn’t that striking. This one is still haunting me, days after seeing the movie. It’s the only truly memorable / enjoyable thing about the movie. But it blew my mind.

No, you don’t remember the completely empty Times Square scene? I still wonder how much that must have cost them.

I checked it out on YouTube. Nope, barely remembered that. It was cool, but I like The Creator’s version better. I can’t wait to rewatch it on YouTube.

I should mention that I saw The Creator in one of those 720 degree theatres and it was my first experience with that. And the 720 mode (projection onto both side walls extending what’s on the main screen) kicked in along with the song and the scene. So it was a trifecta of sensory overload. The 720 thing ultimately proved utterly gimmicky, and I would never pay extra for it again. But I am still thinking of that song, and that scene.

Visually very stunning but as others have noted the plot was not strong. It would be nice for Gemma Chan not just to be a sentient prop in a movie one of these days.

I just looked her up. Hey! I recognize her. She was in Crazy Rich Asians as a model, and the whole point was that she was more than just a Sentient Prop!

Watch Humans! It’s Westworld but good.

Looking it up, it’s sadly not currently on any streaming service in the U.S.